pspax2 vector dna Search Results


g0345 pspax2 addgene  (Addgene inc)
98
Addgene inc g0345 pspax2 addgene
KEY RESOURCES TABLE
G0345 Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+vector+dna/pMD2%2EG+(Plasmid+%2312259)/pmc07266008-1112-151-153
Average 98 stars, based on 1 article reviews
g0345 pspax2 addgene - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier
pspax2 plasmid dna  (Addgene inc)
98
Addgene inc pspax2 plasmid dna
E2F1 is vital for MRN formation in BIN1-deficient nuclei under optimal culture conditions. A, co-IP/Western blot analysis of endogenous E2F1/NBS1 protein complex in DU145±pLPC-BIN1 cell lines in the presence and absence of bleomycin (40 μg/ml, 1 h). B, NBS1 siRNA (si-NBS1) or scrambled control siRNA (si-Cont) was cotransfected with 530ATM-Luc in DU145±sh-BIN1 cells. The raw luciferase activities were normalized with the cotransfected β-gal (pcDNA3–β-gal: 1:10 (w/w)) activity. AU, arbitrary unit. N.S., not significant. C, schematic diagram of ChIP-based in vivo DNA end-binding assay. Cells were transfected with the pGL2-control luciferase (Luc) <t>plasmid</t> <t>DNA</t> linearized by HindIII restriction (pGL2/HindIII-Luc DNA fragment). The super-coiled (uncut) pGL2-Luc plasmid DNA was used as the negative control. D, to determine whether a BIN1 loss enhances the MRE11A/DNA end-binding activity, the indicated 240-bp region of the Luc cDNA was amplified by genomic PCR after an immunoprecipitation with an anti-MRE11A antibody in the DU145±sh-BIN1 cell lysates treated with formaldehyde. E, ChIP-based DNA end-binding assays verified that endogenous NBS1 is vital for the MRE11/DNA-end interaction. To deplete endogenous NBS1 protein, si-NBS1 was cotransfected. F, co-IP/Western blot analysis demonstrated the physical binding of endogenous MRE11A with RAD50 in the presence of bleomycin (20 μg/ml, 30 min). G, co-IP/Western blot analysis verified that similarly to bleomycin treatment, the loss of BIN1 stabilizes the MRE11A/RAD50 protein complex in vivo. H, co-IP/Western blot analysis revealed that the BIN1 loss-mediated stabilization of the MRE11A/RAD50 protein complex was canceled by depleting E2F1. I, scatter plot analysis of the MRE11A foci per nucleus in the DU145±sh-BIN1 (stable) cell lines after transient transfection of si-E2F1 or si-Control. The cells were counterstained with an anti-E2F1 antibody, and the number of MRE11A foci in si-E2F1-transfected nuclei was counted. Horizontal bars indicate mean values.
Pspax2 Plasmid Dna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+vector+dna/psPAX2+(Plasmid+%2312260)/pmc06462522-882-23-30
Average 98 stars, based on 1 article reviews
pspax2 plasmid dna - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier
pspax2 vector dna  (Addgene inc)
93
Addgene inc pspax2 vector dna
E2F1 is vital for MRN formation in BIN1-deficient nuclei under optimal culture conditions. A, co-IP/Western blot analysis of endogenous E2F1/NBS1 protein complex in DU145±pLPC-BIN1 cell lines in the presence and absence of bleomycin (40 μg/ml, 1 h). B, NBS1 siRNA (si-NBS1) or scrambled control siRNA (si-Cont) was cotransfected with 530ATM-Luc in DU145±sh-BIN1 cells. The raw luciferase activities were normalized with the cotransfected β-gal (pcDNA3–β-gal: 1:10 (w/w)) activity. AU, arbitrary unit. N.S., not significant. C, schematic diagram of ChIP-based in vivo DNA end-binding assay. Cells were transfected with the pGL2-control luciferase (Luc) <t>plasmid</t> <t>DNA</t> linearized by HindIII restriction (pGL2/HindIII-Luc DNA fragment). The super-coiled (uncut) pGL2-Luc plasmid DNA was used as the negative control. D, to determine whether a BIN1 loss enhances the MRE11A/DNA end-binding activity, the indicated 240-bp region of the Luc cDNA was amplified by genomic PCR after an immunoprecipitation with an anti-MRE11A antibody in the DU145±sh-BIN1 cell lysates treated with formaldehyde. E, ChIP-based DNA end-binding assays verified that endogenous NBS1 is vital for the MRE11/DNA-end interaction. To deplete endogenous NBS1 protein, si-NBS1 was cotransfected. F, co-IP/Western blot analysis demonstrated the physical binding of endogenous MRE11A with RAD50 in the presence of bleomycin (20 μg/ml, 30 min). G, co-IP/Western blot analysis verified that similarly to bleomycin treatment, the loss of BIN1 stabilizes the MRE11A/RAD50 protein complex in vivo. H, co-IP/Western blot analysis revealed that the BIN1 loss-mediated stabilization of the MRE11A/RAD50 protein complex was canceled by depleting E2F1. I, scatter plot analysis of the MRE11A foci per nucleus in the DU145±sh-BIN1 (stable) cell lines after transient transfection of si-E2F1 or si-Control. The cells were counterstained with an anti-E2F1 antibody, and the number of MRE11A foci in si-E2F1-transfected nuclei was counted. Horizontal bars indicate mean values.
Pspax2 Vector Dna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+vector+dna/6379+H10-K218T+(Plasmid+%231250)/pmc09085742-164-27-30
Average 93 stars, based on 1 article reviews
pspax2 vector dna - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
gene exp btn3a1 hs01063368 m1  (Thermo Fisher)
86
Thermo Fisher gene exp btn3a1 hs01063368 m1
E2F1 is vital for MRN formation in BIN1-deficient nuclei under optimal culture conditions. A, co-IP/Western blot analysis of endogenous E2F1/NBS1 protein complex in DU145±pLPC-BIN1 cell lines in the presence and absence of bleomycin (40 μg/ml, 1 h). B, NBS1 siRNA (si-NBS1) or scrambled control siRNA (si-Cont) was cotransfected with 530ATM-Luc in DU145±sh-BIN1 cells. The raw luciferase activities were normalized with the cotransfected β-gal (pcDNA3–β-gal: 1:10 (w/w)) activity. AU, arbitrary unit. N.S., not significant. C, schematic diagram of ChIP-based in vivo DNA end-binding assay. Cells were transfected with the pGL2-control luciferase (Luc) <t>plasmid</t> <t>DNA</t> linearized by HindIII restriction (pGL2/HindIII-Luc DNA fragment). The super-coiled (uncut) pGL2-Luc plasmid DNA was used as the negative control. D, to determine whether a BIN1 loss enhances the MRE11A/DNA end-binding activity, the indicated 240-bp region of the Luc cDNA was amplified by genomic PCR after an immunoprecipitation with an anti-MRE11A antibody in the DU145±sh-BIN1 cell lysates treated with formaldehyde. E, ChIP-based DNA end-binding assays verified that endogenous NBS1 is vital for the MRE11/DNA-end interaction. To deplete endogenous NBS1 protein, si-NBS1 was cotransfected. F, co-IP/Western blot analysis demonstrated the physical binding of endogenous MRE11A with RAD50 in the presence of bleomycin (20 μg/ml, 30 min). G, co-IP/Western blot analysis verified that similarly to bleomycin treatment, the loss of BIN1 stabilizes the MRE11A/RAD50 protein complex in vivo. H, co-IP/Western blot analysis revealed that the BIN1 loss-mediated stabilization of the MRE11A/RAD50 protein complex was canceled by depleting E2F1. I, scatter plot analysis of the MRE11A foci per nucleus in the DU145±sh-BIN1 (stable) cell lines after transient transfection of si-E2F1 or si-Control. The cells were counterstained with an anti-E2F1 antibody, and the number of MRE11A foci in si-E2F1-transfected nuclei was counted. Horizontal bars indicate mean values.
Gene Exp Btn3a1 Hs01063368 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+vector+dna/Gene+Exp%2E+BTN3A1%2C+Hs01063368_m1/pm34260935-257-10-13
Average 86 stars, based on 1 article reviews
gene exp btn3a1 hs01063368 m1 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
plko 1 shrna control  (Addgene inc)
93
Addgene inc plko 1 shrna control
E2F1 is vital for MRN formation in BIN1-deficient nuclei under optimal culture conditions. A, co-IP/Western blot analysis of endogenous E2F1/NBS1 protein complex in DU145±pLPC-BIN1 cell lines in the presence and absence of bleomycin (40 μg/ml, 1 h). B, NBS1 siRNA (si-NBS1) or scrambled control siRNA (si-Cont) was cotransfected with 530ATM-Luc in DU145±sh-BIN1 cells. The raw luciferase activities were normalized with the cotransfected β-gal (pcDNA3–β-gal: 1:10 (w/w)) activity. AU, arbitrary unit. N.S., not significant. C, schematic diagram of ChIP-based in vivo DNA end-binding assay. Cells were transfected with the pGL2-control luciferase (Luc) <t>plasmid</t> <t>DNA</t> linearized by HindIII restriction (pGL2/HindIII-Luc DNA fragment). The super-coiled (uncut) pGL2-Luc plasmid DNA was used as the negative control. D, to determine whether a BIN1 loss enhances the MRE11A/DNA end-binding activity, the indicated 240-bp region of the Luc cDNA was amplified by genomic PCR after an immunoprecipitation with an anti-MRE11A antibody in the DU145±sh-BIN1 cell lysates treated with formaldehyde. E, ChIP-based DNA end-binding assays verified that endogenous NBS1 is vital for the MRE11/DNA-end interaction. To deplete endogenous NBS1 protein, si-NBS1 was cotransfected. F, co-IP/Western blot analysis demonstrated the physical binding of endogenous MRE11A with RAD50 in the presence of bleomycin (20 μg/ml, 30 min). G, co-IP/Western blot analysis verified that similarly to bleomycin treatment, the loss of BIN1 stabilizes the MRE11A/RAD50 protein complex in vivo. H, co-IP/Western blot analysis revealed that the BIN1 loss-mediated stabilization of the MRE11A/RAD50 protein complex was canceled by depleting E2F1. I, scatter plot analysis of the MRE11A foci per nucleus in the DU145±sh-BIN1 (stable) cell lines after transient transfection of si-E2F1 or si-Control. The cells were counterstained with an anti-E2F1 antibody, and the number of MRE11A foci in si-E2F1-transfected nuclei was counted. Horizontal bars indicate mean values.
Plko 1 Shrna Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+vector+dna/pLKO%2E1+RagA+shRNA+%231+(Plasmid+%2330319)/pmc08570464-207-7-17
Average 93 stars, based on 1 article reviews
plko 1 shrna control - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
envelope vector  (Addgene inc)
93
Addgene inc envelope vector
E2F1 is vital for MRN formation in BIN1-deficient nuclei under optimal culture conditions. A, co-IP/Western blot analysis of endogenous E2F1/NBS1 protein complex in DU145±pLPC-BIN1 cell lines in the presence and absence of bleomycin (40 μg/ml, 1 h). B, NBS1 siRNA (si-NBS1) or scrambled control siRNA (si-Cont) was cotransfected with 530ATM-Luc in DU145±sh-BIN1 cells. The raw luciferase activities were normalized with the cotransfected β-gal (pcDNA3–β-gal: 1:10 (w/w)) activity. AU, arbitrary unit. N.S., not significant. C, schematic diagram of ChIP-based in vivo DNA end-binding assay. Cells were transfected with the pGL2-control luciferase (Luc) <t>plasmid</t> <t>DNA</t> linearized by HindIII restriction (pGL2/HindIII-Luc DNA fragment). The super-coiled (uncut) pGL2-Luc plasmid DNA was used as the negative control. D, to determine whether a BIN1 loss enhances the MRE11A/DNA end-binding activity, the indicated 240-bp region of the Luc cDNA was amplified by genomic PCR after an immunoprecipitation with an anti-MRE11A antibody in the DU145±sh-BIN1 cell lysates treated with formaldehyde. E, ChIP-based DNA end-binding assays verified that endogenous NBS1 is vital for the MRE11/DNA-end interaction. To deplete endogenous NBS1 protein, si-NBS1 was cotransfected. F, co-IP/Western blot analysis demonstrated the physical binding of endogenous MRE11A with RAD50 in the presence of bleomycin (20 μg/ml, 30 min). G, co-IP/Western blot analysis verified that similarly to bleomycin treatment, the loss of BIN1 stabilizes the MRE11A/RAD50 protein complex in vivo. H, co-IP/Western blot analysis revealed that the BIN1 loss-mediated stabilization of the MRE11A/RAD50 protein complex was canceled by depleting E2F1. I, scatter plot analysis of the MRE11A foci per nucleus in the DU145±sh-BIN1 (stable) cell lines after transient transfection of si-E2F1 or si-Control. The cells were counterstained with an anti-E2F1 antibody, and the number of MRE11A foci in si-E2F1-transfected nuclei was counted. Horizontal bars indicate mean values.
Envelope Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+vector+dna/pLVUHshp53+(Plasmid+%2311653)/pmc07534927-244-21-26
Average 93 stars, based on 1 article reviews
envelope vector - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
pspax2  (Addgene inc)
92
Addgene inc pspax2
E2F1 is vital for MRN formation in BIN1-deficient nuclei under optimal culture conditions. A, co-IP/Western blot analysis of endogenous E2F1/NBS1 protein complex in DU145±pLPC-BIN1 cell lines in the presence and absence of bleomycin (40 μg/ml, 1 h). B, NBS1 siRNA (si-NBS1) or scrambled control siRNA (si-Cont) was cotransfected with 530ATM-Luc in DU145±sh-BIN1 cells. The raw luciferase activities were normalized with the cotransfected β-gal (pcDNA3–β-gal: 1:10 (w/w)) activity. AU, arbitrary unit. N.S., not significant. C, schematic diagram of ChIP-based in vivo DNA end-binding assay. Cells were transfected with the pGL2-control luciferase (Luc) <t>plasmid</t> <t>DNA</t> linearized by HindIII restriction (pGL2/HindIII-Luc DNA fragment). The super-coiled (uncut) pGL2-Luc plasmid DNA was used as the negative control. D, to determine whether a BIN1 loss enhances the MRE11A/DNA end-binding activity, the indicated 240-bp region of the Luc cDNA was amplified by genomic PCR after an immunoprecipitation with an anti-MRE11A antibody in the DU145±sh-BIN1 cell lysates treated with formaldehyde. E, ChIP-based DNA end-binding assays verified that endogenous NBS1 is vital for the MRE11/DNA-end interaction. To deplete endogenous NBS1 protein, si-NBS1 was cotransfected. F, co-IP/Western blot analysis demonstrated the physical binding of endogenous MRE11A with RAD50 in the presence of bleomycin (20 μg/ml, 30 min). G, co-IP/Western blot analysis verified that similarly to bleomycin treatment, the loss of BIN1 stabilizes the MRE11A/RAD50 protein complex in vivo. H, co-IP/Western blot analysis revealed that the BIN1 loss-mediated stabilization of the MRE11A/RAD50 protein complex was canceled by depleting E2F1. I, scatter plot analysis of the MRE11A foci per nucleus in the DU145±sh-BIN1 (stable) cell lines after transient transfection of si-E2F1 or si-Control. The cells were counterstained with an anti-E2F1 antibody, and the number of MRE11A foci in si-E2F1-transfected nuclei was counted. Horizontal bars indicate mean values.
Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+vector+dna/T4+Lysozyme+T115A+WT*+(Plasmid+%2318518)/pmc07818936-157-33-8
Average 92 stars, based on 1 article reviews
pspax2 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
packaging vector pspax2  (Addgene inc)
93
Addgene inc packaging vector pspax2
E2F1 is vital for MRN formation in BIN1-deficient nuclei under optimal culture conditions. A, co-IP/Western blot analysis of endogenous E2F1/NBS1 protein complex in DU145±pLPC-BIN1 cell lines in the presence and absence of bleomycin (40 μg/ml, 1 h). B, NBS1 siRNA (si-NBS1) or scrambled control siRNA (si-Cont) was cotransfected with 530ATM-Luc in DU145±sh-BIN1 cells. The raw luciferase activities were normalized with the cotransfected β-gal (pcDNA3–β-gal: 1:10 (w/w)) activity. AU, arbitrary unit. N.S., not significant. C, schematic diagram of ChIP-based in vivo DNA end-binding assay. Cells were transfected with the pGL2-control luciferase (Luc) <t>plasmid</t> <t>DNA</t> linearized by HindIII restriction (pGL2/HindIII-Luc DNA fragment). The super-coiled (uncut) pGL2-Luc plasmid DNA was used as the negative control. D, to determine whether a BIN1 loss enhances the MRE11A/DNA end-binding activity, the indicated 240-bp region of the Luc cDNA was amplified by genomic PCR after an immunoprecipitation with an anti-MRE11A antibody in the DU145±sh-BIN1 cell lysates treated with formaldehyde. E, ChIP-based DNA end-binding assays verified that endogenous NBS1 is vital for the MRE11/DNA-end interaction. To deplete endogenous NBS1 protein, si-NBS1 was cotransfected. F, co-IP/Western blot analysis demonstrated the physical binding of endogenous MRE11A with RAD50 in the presence of bleomycin (20 μg/ml, 30 min). G, co-IP/Western blot analysis verified that similarly to bleomycin treatment, the loss of BIN1 stabilizes the MRE11A/RAD50 protein complex in vivo. H, co-IP/Western blot analysis revealed that the BIN1 loss-mediated stabilization of the MRE11A/RAD50 protein complex was canceled by depleting E2F1. I, scatter plot analysis of the MRE11A foci per nucleus in the DU145±sh-BIN1 (stable) cell lines after transient transfection of si-E2F1 or si-Control. The cells were counterstained with an anti-E2F1 antibody, and the number of MRE11A foci in si-E2F1-transfected nuclei was counted. Horizontal bars indicate mean values.
Packaging Vector Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+vector+dna/pBT100%2E136c+(Plasmid+%23122603)/pmc11077057-93-26-29
Average 93 stars, based on 1 article reviews
packaging vector pspax2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
pspax2 packaging vector  (Addgene inc)
91
Addgene inc pspax2 packaging vector
E2F1 is vital for MRN formation in BIN1-deficient nuclei under optimal culture conditions. A, co-IP/Western blot analysis of endogenous E2F1/NBS1 protein complex in DU145±pLPC-BIN1 cell lines in the presence and absence of bleomycin (40 μg/ml, 1 h). B, NBS1 siRNA (si-NBS1) or scrambled control siRNA (si-Cont) was cotransfected with 530ATM-Luc in DU145±sh-BIN1 cells. The raw luciferase activities were normalized with the cotransfected β-gal (pcDNA3–β-gal: 1:10 (w/w)) activity. AU, arbitrary unit. N.S., not significant. C, schematic diagram of ChIP-based in vivo DNA end-binding assay. Cells were transfected with the pGL2-control luciferase (Luc) <t>plasmid</t> <t>DNA</t> linearized by HindIII restriction (pGL2/HindIII-Luc DNA fragment). The super-coiled (uncut) pGL2-Luc plasmid DNA was used as the negative control. D, to determine whether a BIN1 loss enhances the MRE11A/DNA end-binding activity, the indicated 240-bp region of the Luc cDNA was amplified by genomic PCR after an immunoprecipitation with an anti-MRE11A antibody in the DU145±sh-BIN1 cell lysates treated with formaldehyde. E, ChIP-based DNA end-binding assays verified that endogenous NBS1 is vital for the MRE11/DNA-end interaction. To deplete endogenous NBS1 protein, si-NBS1 was cotransfected. F, co-IP/Western blot analysis demonstrated the physical binding of endogenous MRE11A with RAD50 in the presence of bleomycin (20 μg/ml, 30 min). G, co-IP/Western blot analysis verified that similarly to bleomycin treatment, the loss of BIN1 stabilizes the MRE11A/RAD50 protein complex in vivo. H, co-IP/Western blot analysis revealed that the BIN1 loss-mediated stabilization of the MRE11A/RAD50 protein complex was canceled by depleting E2F1. I, scatter plot analysis of the MRE11A foci per nucleus in the DU145±sh-BIN1 (stable) cell lines after transient transfection of si-E2F1 or si-Control. The cells were counterstained with an anti-E2F1 antibody, and the number of MRE11A foci in si-E2F1-transfected nuclei was counted. Horizontal bars indicate mean values.
Pspax2 Packaging Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+vector+dna/pCS2-hSeparase-wt+(Plasmid+%2333016)/bio_rxiv__2023__07__14__549074-120-5-8
Average 91 stars, based on 1 article reviews
pspax2 packaging vector - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier
fugenehd  (Promega)
90
Promega fugenehd
E2F1 is vital for MRN formation in BIN1-deficient nuclei under optimal culture conditions. A, co-IP/Western blot analysis of endogenous E2F1/NBS1 protein complex in DU145±pLPC-BIN1 cell lines in the presence and absence of bleomycin (40 μg/ml, 1 h). B, NBS1 siRNA (si-NBS1) or scrambled control siRNA (si-Cont) was cotransfected with 530ATM-Luc in DU145±sh-BIN1 cells. The raw luciferase activities were normalized with the cotransfected β-gal (pcDNA3–β-gal: 1:10 (w/w)) activity. AU, arbitrary unit. N.S., not significant. C, schematic diagram of ChIP-based in vivo DNA end-binding assay. Cells were transfected with the pGL2-control luciferase (Luc) <t>plasmid</t> <t>DNA</t> linearized by HindIII restriction (pGL2/HindIII-Luc DNA fragment). The super-coiled (uncut) pGL2-Luc plasmid DNA was used as the negative control. D, to determine whether a BIN1 loss enhances the MRE11A/DNA end-binding activity, the indicated 240-bp region of the Luc cDNA was amplified by genomic PCR after an immunoprecipitation with an anti-MRE11A antibody in the DU145±sh-BIN1 cell lysates treated with formaldehyde. E, ChIP-based DNA end-binding assays verified that endogenous NBS1 is vital for the MRE11/DNA-end interaction. To deplete endogenous NBS1 protein, si-NBS1 was cotransfected. F, co-IP/Western blot analysis demonstrated the physical binding of endogenous MRE11A with RAD50 in the presence of bleomycin (20 μg/ml, 30 min). G, co-IP/Western blot analysis verified that similarly to bleomycin treatment, the loss of BIN1 stabilizes the MRE11A/RAD50 protein complex in vivo. H, co-IP/Western blot analysis revealed that the BIN1 loss-mediated stabilization of the MRE11A/RAD50 protein complex was canceled by depleting E2F1. I, scatter plot analysis of the MRE11A foci per nucleus in the DU145±sh-BIN1 (stable) cell lines after transient transfection of si-E2F1 or si-Control. The cells were counterstained with an anti-E2F1 antibody, and the number of MRE11A foci in si-E2F1-transfected nuclei was counted. Horizontal bars indicate mean values.
Fugenehd, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2+vector+dna/fugene+hd/pmc07710560-96-18-19
Average 90 stars, based on 1 article reviews
fugenehd - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell

Article Title: Endocrine-exocrine signaling drives obesity-associated pancreatic ductal adenocarcinoma

doi: 10.1016/j.cell.2020.03.062

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Davis (University of Wisconsin) N/A Mouse: Kras LSL-G12D : B6.129S4- Kras tm4Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008179, RRID:IMSR_JAX:008179 Mouse: p53 KO/WT :129- Trp53 tm1Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:002080, RRID:IMSR_JAX:002080 Mouse: p53 R172H/WT : 129S-Trp53 tm2Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008652, RRID:IMSR_JAX:008652 Mouse: Kras LA2 :129S/Sv- Kras tm3Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008185, RRID:IMSR_JAX:008185 Mouse: C57BL/6J : C57/B6 Jackson Laboratories IMSR Cat# JAX:000664, RRID:IMSR_JAX:000664 Oligonucleotides Leptin cDNA Reverse Koch Institute Swanson Biotechnology Center TCAGCATTCAGGGCTAACATCCAACT mLepR sgRNA Forward Keck Biotechnology Center at Yale CACCGTGAAAGCCACCAGACCTCGA mLepR sgRNA Reverse Keck Biotechnology Center at Yale AAACTCGAGGTCTGGTGGCTTTCAC mLepR Target Site Forward Keck Biotechnology Center at Yale GGTTCTCAGTGCACGCATTT mLepR Target Site Reverse Keck Biotechnology Center at Yale ACAACGATTTTCCTGGCATCT Leptin cDNA Forward Koch Institute Swanson Biotechnology Center ATGTGCTGGAGACCCCTGT Recombinant DNA lentiGuide-puro Addgene Cat# 52963 lentiCas9-blast Addgene Cat# 52962 pFBAAVCAGmcsBgHpa University of Iowa Viral Vector Core Cat# G0345 psPAX2 Addgene Cat# 12259 pCMV-VSV-G Addgene Cat# 8454 Software and Algorithms ImageJ NIH N/A QuPath v0.1.2 Github N/A Prism v8.0 Graphpad N/A Image Studio Lite LI-COR N/A PHATE https://github.com/KrishnaswamyLab/PHATE N/A MAGIC https://github.com/KrishnaswamyLab/MAGIC N/A FASTX-toolkit Greg Hannon lab ( http://hannonlab.cshl.edu/fastx_toolkit ) N/A Burrows-Wheeler Aligner v0.5.5 Source Forge N/A Picard toolkit v1.21 Github N/A GATK v.1.0.5538 Broad Institute N/A ANNOVAR http://annovar.openbioinformatics.org/ N/A RSEM v.1.2.12 Dewey lab/Github N/A Cytoscape v.3.3.0 Cytoscape Consortium N/A Cell Ranger 10X Genomics N/A SAS v9.4 SAS Institute, Inc. N/A MELD https://github.com/KrishnaswamyLab/MELD N/A diffxpy https://github.com/theislab/diffxpy/ N/A R package JADE https://www.rdocumentation.org/packages/JADE/versions/1.1-0 N/A Open in a separate window KEY RESOURCES TABLE

Techniques: Virus, Plasmid Preparation, Generated, Transplantation Assay, Recombinant, DNA Extraction, Lysis, Extraction, Blocking Assay, Western Blot, Enzyme-linked Immunosorbent Assay, Cell Viability Assay, Reverse Transcription, Bicinchoninic Acid Protein Assay, Picogreen Assay, Derivative Assay, Software

E2F1 is vital for MRN formation in BIN1-deficient nuclei under optimal culture conditions. A, co-IP/Western blot analysis of endogenous E2F1/NBS1 protein complex in DU145±pLPC-BIN1 cell lines in the presence and absence of bleomycin (40 μg/ml, 1 h). B, NBS1 siRNA (si-NBS1) or scrambled control siRNA (si-Cont) was cotransfected with 530ATM-Luc in DU145±sh-BIN1 cells. The raw luciferase activities were normalized with the cotransfected β-gal (pcDNA3–β-gal: 1:10 (w/w)) activity. AU, arbitrary unit. N.S., not significant. C, schematic diagram of ChIP-based in vivo DNA end-binding assay. Cells were transfected with the pGL2-control luciferase (Luc) plasmid DNA linearized by HindIII restriction (pGL2/HindIII-Luc DNA fragment). The super-coiled (uncut) pGL2-Luc plasmid DNA was used as the negative control. D, to determine whether a BIN1 loss enhances the MRE11A/DNA end-binding activity, the indicated 240-bp region of the Luc cDNA was amplified by genomic PCR after an immunoprecipitation with an anti-MRE11A antibody in the DU145±sh-BIN1 cell lysates treated with formaldehyde. E, ChIP-based DNA end-binding assays verified that endogenous NBS1 is vital for the MRE11/DNA-end interaction. To deplete endogenous NBS1 protein, si-NBS1 was cotransfected. F, co-IP/Western blot analysis demonstrated the physical binding of endogenous MRE11A with RAD50 in the presence of bleomycin (20 μg/ml, 30 min). G, co-IP/Western blot analysis verified that similarly to bleomycin treatment, the loss of BIN1 stabilizes the MRE11A/RAD50 protein complex in vivo. H, co-IP/Western blot analysis revealed that the BIN1 loss-mediated stabilization of the MRE11A/RAD50 protein complex was canceled by depleting E2F1. I, scatter plot analysis of the MRE11A foci per nucleus in the DU145±sh-BIN1 (stable) cell lines after transient transfection of si-E2F1 or si-Control. The cells were counterstained with an anti-E2F1 antibody, and the number of MRE11A foci in si-E2F1-transfected nuclei was counted. Horizontal bars indicate mean values.

Journal: The Journal of Biological Chemistry

Article Title: Loss of the tumor suppressor BIN1 enables ATM Ser/Thr kinase activation by the nuclear protein E2F1 and renders cancer cells resistant to cisplatin

doi: 10.1074/jbc.RA118.005699

Figure Lengend Snippet: E2F1 is vital for MRN formation in BIN1-deficient nuclei under optimal culture conditions. A, co-IP/Western blot analysis of endogenous E2F1/NBS1 protein complex in DU145±pLPC-BIN1 cell lines in the presence and absence of bleomycin (40 μg/ml, 1 h). B, NBS1 siRNA (si-NBS1) or scrambled control siRNA (si-Cont) was cotransfected with 530ATM-Luc in DU145±sh-BIN1 cells. The raw luciferase activities were normalized with the cotransfected β-gal (pcDNA3–β-gal: 1:10 (w/w)) activity. AU, arbitrary unit. N.S., not significant. C, schematic diagram of ChIP-based in vivo DNA end-binding assay. Cells were transfected with the pGL2-control luciferase (Luc) plasmid DNA linearized by HindIII restriction (pGL2/HindIII-Luc DNA fragment). The super-coiled (uncut) pGL2-Luc plasmid DNA was used as the negative control. D, to determine whether a BIN1 loss enhances the MRE11A/DNA end-binding activity, the indicated 240-bp region of the Luc cDNA was amplified by genomic PCR after an immunoprecipitation with an anti-MRE11A antibody in the DU145±sh-BIN1 cell lysates treated with formaldehyde. E, ChIP-based DNA end-binding assays verified that endogenous NBS1 is vital for the MRE11/DNA-end interaction. To deplete endogenous NBS1 protein, si-NBS1 was cotransfected. F, co-IP/Western blot analysis demonstrated the physical binding of endogenous MRE11A with RAD50 in the presence of bleomycin (20 μg/ml, 30 min). G, co-IP/Western blot analysis verified that similarly to bleomycin treatment, the loss of BIN1 stabilizes the MRE11A/RAD50 protein complex in vivo. H, co-IP/Western blot analysis revealed that the BIN1 loss-mediated stabilization of the MRE11A/RAD50 protein complex was canceled by depleting E2F1. I, scatter plot analysis of the MRE11A foci per nucleus in the DU145±sh-BIN1 (stable) cell lines after transient transfection of si-E2F1 or si-Control. The cells were counterstained with an anti-E2F1 antibody, and the number of MRE11A foci in si-E2F1-transfected nuclei was counted. Horizontal bars indicate mean values.

Article Snippet: The human BIN1 sh-RNA–expressing lentivirus plasmid DNA (sc-29804-SH, Santa Cruz Biotechnology) was cotransfected in the HEK293T cells (a packaging cell line) with the psPAX2 plasmid DNA (a lentivirus packaging vector) (Addgene, Cambridge, MA) and the pMD2.G plasmid DNA (a lentivirus VSV-G envelope–expressing vector) (Addgene).

Techniques: Co-Immunoprecipitation Assay, Western Blot, Luciferase, Activity Assay, In Vivo, Binding Assay, Transfection, Plasmid Preparation, Negative Control, Amplification, Immunoprecipitation, Stable Transfection